Review



algorithms imagej schneider  (Bio-Rad)


Bioz Verified Symbol Bio-Rad is a verified supplier
Bioz Manufacturer Symbol Bio-Rad manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98

    Structured Review

    Bio-Rad algorithms imagej schneider
    Algorithms Imagej Schneider, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 98/100, based on 4012 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+imagej+schneider/CFX+Maestro+Software/pm41722047-185-241-252
    Average 98 stars, based on 4012 article reviews
    algorithms imagej schneider - by Bioz Stars, 2026-09
    98/100 stars

    Images

    Related Articles

    Software:

    Article Title: Formation of I 2 +III 2 supercomplex rescues respiratory chain defects.
    Article Snippet: In brief Respiratory supercomplexes are conserved throughout evolution, but their physiological relevance remains contentious.. Here, Liang et al. discover an I2+III2 supercomplex (SC-XL) triggered by complex III deficiency that rescues respiration by enhancing OXPHOS and reducing ROS production.. These findings indicate that supercomplexes are indispensable for maintaining mitochondrial homeostasis and integrity during metabolic stress.

    Article Title: Timer-based proteomic profiling of the ubiquitin-proteasome system reveals a substrate receptor of the GID ubiquitin ligase
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER pRS413-GPDpr-GPM3(T2A)mCherry-sfGFP This study N/A pRS413-GPDpr-GPM3(T2G)mCherry-sfGFP This study N/A pRS413-GPDpr-YOR283WmCherry-sfGFP This study N/A pRS413-GPDpr-YOR283W(T2A)mCherry-sfGFP This study N/A pRS413-GPDpr-YOR283W(T2G)mCherry-sfGFP This study N/A pRS413-GPDpr-HA-Luc This study N/A pRS413-GPDpr-HA-Luc-GID11C20 This study N/A pRS413-GPDpr-HA-Luc-GID4C20 This study N/A pRS413-GPDpr-PHM8(HSM32-5)mCherry-sfGFP This study N/A pRS413-GPDpr-PHM8(GPM32-5)mCherry-sfGFP This study N/A pRS413-GPDpr-PHM8(CPA12-5)mCherry-sfGFP This study N/A pRS413-GPDpr-PHM8(BLM102-5)mCherry-sfGFP This study N/A pRS413-GPDpr-PHM8(MDH22-5)mCherry-sfGFP This study N/A pRS413-GPDpr-PHM8(YOR283W2-5)mCherry-sfGFP This study N/A Software and algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ ImageLab Bio-Rad http://www.bio-rad.com/en-us/product/ image-lab-software?ID=KRE6P5E8Z R R Foundation for Statistical Computing https://www.R-project.org/ Phobius K€all et al., 2004 N/A TMHMM Krogh et al., 2001 N/A InterPro database Mitchell et al., 2019 N/A SignalP Petersen et al., 2011 N/A MUSCLE Edgar, 2004 https://www.ebi.ac.uk/Tools/msa/muscle/ JalView Waterhouse et al., 2009 https://www.jalview.org/ Revigo Supek et al., 2011 http://revigo.irb.hr/ ll OPEN ACCESS Resource ..

    other:

    Article Title: GPR75 in glutamatergic neurons regulates body weight.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Gpr75 Novus Biologicals Cat# NBP1-59406; RRID: AB_11037221 Opal570 Akoya Biosciences Cat# FP1488001KT; RRID: AB_3739820 Opal520 Akoya Biosciences Cat# FP1487001KT; RRID: AB_3739821 Chemicals, peptides, and recombinant proteins Alt-R TM S.p. dCas9 Protein V3 Integrated DNA Technologies Cat#1081067 Gpr75 (NINQMPIPSA(R10), AQUA QuantProHeavy ThermoFisher N/A Critical commercial assays Multiplex fluorescent kit Bio-techne Cat# 323110 Aurum TM Total RNA Fatty and Fibrous Tissue Kit Biorad Cat# 7326830 High-Capacity cDNA Synthesis Kit Applied Biosystems Cat# 43-688-14 BCA protein assay kit ThermoFisher Cat# A55864 protein A/G beads ThermoFisher Cat# 88803 Deposited data Adulescent Mouse Brain Atlas Zeisel et al. 29 http://mousebrain.org Mendeley data (raw data) This manuscript Mendeley Data: http://doi.org/10.17632/ 789hrg254v.1 Experimental models: Organisms/strains vGlut2-Cre (Slc17a6 tm2(cre)Lowl ) Vong et al. 32 Bradford Lowell vGat-Cre (B6J.129S6(FVB)-Slc32a1 tm2(cre)Lowl /MwarJ) Vong et al. 32 Bradford Lowell Cmv-Cre (B6.C-Tg(CMV-cre)1Cgn/J) Jackson Labs RRID:IMSR_JAX:006054 Gpr75 flox This manuscript N/A Gpr75 TB This manuscript N/A Oligonucleotides 5 ′ Gpr75 floxed Alt-R CRISPR-Cas9 gRNA CAGGAAUACGACCUCUCCAUGUUUU AGAGCUAUGCU This manuscript Integrated DNA Technologies (IDT) N/A 3 ′ Gpr75 floxed Alt-R CRISPR-Cas9 gRNA UAGAGGAUUGUACUACAGUAGUUUU AGAGCUAUGCU This manuscript Integrated DNA Technologies (IDT) N/A Gpr75 TB floxed Alt-R CRISPR-Cas9 gRNA CAUUGGGGACAUUCUGAAGCGUUUU AGAGCUAUGCU This manuscript Integrated DNA Technologies (IDT) N/A Alt-R TM CRISPR-Cas9 tracrRNA Integrated DNA Technologies (IDT) Cat# 1072532 qPCR probes: Table S1 Life Biotechnologies N/A Genotyping primers: Table S1 Integrated DNA Technologies (IDT) N/A RNAscope Probe Gpr75 Bio-techne cat# 318281-c1 RNAscope Probe Slc17a6 Bio-techne cat#319171-c2 RNAscope Probe Gad1 Bio-techne cat#400951-C2 Software and algorithms ImageJ Schneider et al. 71 https://imagej.nih.gov/ij/ CFX maestro Software v2.3 Biorad #12013758 DIA-NN v1.8.1 Demichev et al. 72 https://aptila.bio Prism (version 10.4.0) GraphPad www.graphpad.com Other High Fat Diet Research Diets Inc D12492 12 Cell Reports 45, 117011, March 24, 2026

    Article Title: Mitochondrial microproteins link metabolic cues to respiratory chain biogenesis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines Human HEK293T ATCC Cat#CRL-3216 Mouse C2C12 ATCC Cat#CRL-1772 Experimental models: Organisms/strains Mouse: WT (C57BL/6J) The Jackson Laboratory Cat#000664 Mouse: BR / (C57BL/6J) This paper NA Oligonucleotides For genotyping primers, gRNAs, and qPCR primers, see Table S3 N/A N/A Recombinant DNA lentiCRISPRv2 puro Gift from Shang Li Lab NA psAAV-CMV-mBrawnin-FLAG This paper NA psAAV-CMV-mSmim4-FLAG This paper NA psAAV-CMV-GFP This paper NA pCDH-CMV-mSmim4-FLAG This paper NA pCDH-CMV-mBrawnin-FLAG This paper NA pCDH-CMV-mC16orf91-FLAG This paper NA pCDH-CMV-mUqcc1-FLAG This paper NA pCDH-CMV-mUqcc3-FLAG This paper NA pCDH-CMV-mUqcrq-FLAG This paper NA Software and algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ Image Lab Software for PC Version 6.1 Bio-Rad SOFT-LIT-170-9690-ILSPC-V-6-1 MaxQuant platform MaxQuant (version 1.6.17.0) Perseus framework Perseus (version 1.6.10.43) PyMOL 2 PyMOL https://pymol.org/2/



    Similar Products

    99
    Oxford Instruments algorithms imagej fiji schneider
    Algorithms Imagej Fiji Schneider, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+imagej+schneider/Imaris/pm41689806-832-115-121
    Average 99 stars, based on 1 article reviews
    algorithms imagej fiji schneider - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    98
    Bio-Rad algorithms imagej schneider
    Algorithms Imagej Schneider, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+imagej+schneider/CFX+Maestro+Software/pm41722047-185-241-252
    Average 98 stars, based on 1 article reviews
    algorithms imagej schneider - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    91
    Addgene inc algorithms imagej schneider
    Algorithms Imagej Schneider, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+imagej+schneider/1XDR4+(Plasmid+%2332614)/pm41468888-227-202-199
    Average 91 stars, based on 1 article reviews
    algorithms imagej schneider - by Bioz Stars, 2026-09
    91/100 stars
      Buy from Supplier

    99
    Nikon algorithms imagej fiji schneider
    Algorithms Imagej Fiji Schneider, supplied by Nikon, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+imagej+schneider/NIS-Elements/pm41385382-60-8-17
    Average 99 stars, based on 1 article reviews
    algorithms imagej fiji schneider - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    Oxford Instruments algorithms imagej 1 54 p schneider
    Algorithms Imagej 1 54 P Schneider, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+imagej+schneider/Imaris/pm40359937-568-128-135
    Average 99 stars, based on 1 article reviews
    algorithms imagej 1 54 p schneider - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    Oxford Instruments algorithms imagej schneider
    Algorithms Imagej Schneider, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+imagej+schneider/Imaris/pm39461340-271-157-163
    Average 99 stars, based on 1 article reviews
    algorithms imagej schneider - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    Oxford Instruments algorithms imaris oxford instruments rrid scr 007370 arivis zeiss rrid scr 018000 imagej schneider
    Algorithms Imaris Oxford Instruments Rrid Scr 007370 Arivis Zeiss Rrid Scr 018000 Imagej Schneider, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+imagej+schneider/Imaris/pm40220290-144-179-180
    Average 99 stars, based on 1 article reviews
    algorithms imaris oxford instruments rrid scr 007370 arivis zeiss rrid scr 018000 imagej schneider - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    Nikon algorithms imaris oxford instruments rrid scr 007370 arivis zeiss rrid scr 018000 imagej schneider
    Algorithms Imaris Oxford Instruments Rrid Scr 007370 Arivis Zeiss Rrid Scr 018000 Imagej Schneider, supplied by Nikon, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+imagej+schneider/NIS-Elements/pm40220290-144-179-194
    Average 99 stars, based on 1 article reviews
    algorithms imaris oxford instruments rrid scr 007370 arivis zeiss rrid scr 018000 imagej schneider - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    Image Search Results